gaa

Ensembl ID:
ENSDARG00000090714
ZFIN ID:
ZDB-GENE-070212-2
Human Orthologue:
GAA
Human Description:
glucosidase, alpha; acid [Source:HGNC Symbol;Acc:4065]
Mouse Orthologue:
Gaa
Mouse Description:
glucosidase, alpha, acid Gene [Source:MGI Symbol;Acc:MGI:95609]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11797 Nonsense Available for shipment Available now
sa33128 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127796 Nonsense 525 918 10 19
ENSDART00000144222   None 290 None 7
Genomic Location:
Chromosome 3 (position 18153258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGCTCTGTGGATGGATGTCCTGACTCTGAATTGGAGAAACCACCATA[T/A]ACACCAGGTCACAATACWAAASTCTTTTTAGTAGAATACTATCACTNCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127796 Nonsense 719 918 15 19
ENSDART00000144222 Nonsense 91 290 3 7
Genomic Location:
Chromosome 3 (position 18157444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTACTGACATTTGCTCATTTCTTTCAGGTTCCCCACTGATCCAGATTG[C/A]AGGAGCATTGACAGACAGTTCCTGTGGGGGAGTTCACTGCTCATCAGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link