LOC100333218

Ensembl ID:
ENSDARG00000090707
Mouse Orthologues:
BC023105, Gm12185, Gm5431, Ifi47, Irgc1, Irgm1, Irgm2
Mouse Descriptions:
cDNA sequence BC023105 Pseudogene [Source:MGI Symbol;Acc:MGI:2384767]
immunity-related GTPase family M member 1 Gene [Source:MGI Symbol;Acc:MGI:107567]
immunity-related GTPase family M member 2 Gene [Source:MGI Symbol;Acc:MGI:1926262]
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
predicted gene 12185 Gene [Source:MGI Symbol;Acc:MGI:3652173]
predicted gene 5431 Gene [Source:MGI Symbol;Acc:MGI:3645205]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14118 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122355 Nonsense 168 648 1 1
Genomic Location:
Chromosome 16 (position 28192890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAAATTAATATTCCAATTCAAATAACTAATGATGATVAAAATAGAT[T/A]GATTAGACAAAAGGGTGAAAAAGCAACAGARATCCTTAAAACAAAGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iyf6ne7a