LOC566259

Ensembl ID:
ENSDARG00000090702
Human Orthologues:
MAPKBP1, WDR62
Human Descriptions:
mitogen-activated protein kinase binding protein 1 [Source:HGNC Symbol;Acc:29536]
WD repeat domain 62 [Source:HGNC Symbol;Acc:24502]
Mouse Orthologues:
Mapkbp1, Wdr62
Mouse Descriptions:
mitogen-activated protein kinase binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1347004]
WD repeat domain 62 Gene [Source:MGI Symbol;Acc:MGI:1923696]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42877 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131157 Nonsense 321 568 4 6
Genomic Location (Zv9):
Chromosome 17 (position 10559459)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10542899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGCTGAGTGCTGGCTCTGGAAACTCTTCCTCTAAAGGTTTCCAGGTC[A/T]AACTGACTGGCAGTGCTCGACCCCTGCTCCATATAGACATTCCAAATCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link