eif3ea

Ensembl ID:
ENSDARG00000090697
ZFIN ID:
ZDB-GENE-030131-3827
Description:
Eukaryotic translation initiation factor 3 subunit E-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DRI1]
Human Orthologue:
EIF3E
Human Description:
eukaryotic translation initiation factor 3, subunit E [Source:HGNC Symbol;Acc:3277]
Mouse Orthologue:
Eif3e
Mouse Description:
eukaryotic translation initiation factor 3, subunit E Gene [Source:MGI Symbol;Acc:MGI:99257]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22915 Essential Splice Site Available for shipment Available now
sa4677 Nonsense F2 line generated During 2016
sa32103 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Essential Splice Site 200 446 6 13
ENSDART00000140684 Essential Splice Site None 109 5 7
ENSDART00000144651 Essential Splice Site 58 157 2 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 41258448)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38643248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGCCATGGAAGACCTGACCCGCCTGAGGGAGACTATCGATAACAAT[G/T]TAATGCCCCGCCACTCAGAATTCAATACCACATTCGGATTCCCTTACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4677
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Nonsense 251 446 8 13
ENSDART00000140684   None 109 7 7
ENSDART00000144651 Nonsense 98 157 4 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 41248050)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38632850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTGTTTGTTTTGTTTACAGGTACCTCAATGCTATTCAGACCATGTG[T/A]CCACACATACTGCGCTATCTGACCACAGCCGTCATCACCAACAAGGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Essential Splice Site 389 446 11 13
ENSDART00000140684   None 109 None 7
ENSDART00000144651   None 157 None 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 41226435)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38611235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCTCATTCGTAATGCCAGGCTGGATGCCAAAATCGACTCCAAACTGG[T/C]GAGAGTCTCTCATATTTTATTTCGCTCTTGTTTCCCTGCCTCCCTCCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link