eif3ea

Ensembl ID:
ENSDARG00000090697
ZFIN ID:
ZDB-GENE-030131-3827
Description:
Eukaryotic translation initiation factor 3 subunit E-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DRI1]
Human Orthologue:
EIF3E
Human Description:
eukaryotic translation initiation factor 3, subunit E [Source:HGNC Symbol;Acc:3277]
Mouse Orthologue:
Eif3e
Mouse Description:
eukaryotic translation initiation factor 3, subunit E Gene [Source:MGI Symbol;Acc:MGI:99257]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22915 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4677 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa22915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Essential Splice Site 200 446 6 13
ENSDART00000140684 Essential Splice Site None 109 5 7
ENSDART00000144651 Essential Splice Site 58 157 2 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 41258448)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGCCATGGAAGACCTGACCCGCCTGAGGGAGACTATCGATAACAAT[G/T]TAATGCCCCGCCACTCAGAATTCAATACCACATTCGGATTCCCTTACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4677
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126705 Nonsense 251 446 8 13
ENSDART00000140684 None None 109 7 7
ENSDART00000144651 Nonsense 98 157 4 5

The following transcripts of ENSDARG00000090697 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 41248050)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTGTTTGTTTTGTTTACAGGTACCTCAATGCTATTCAGACCATGTG[T/A]CCACACATACTGCGCTATCTGACCACAGCCGTCATCACCAACAAGGACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mnawbcv1