nell2a

Ensembl ID:
ENSDARG00000090690
ZFIN ID:
ZDB-GENE-030131-7972
Human Orthologue:
NELL2
Human Description:
NEL-like 2 (chicken) [Source:HGNC Symbol;Acc:7751]
Mouse Orthologue:
Nell2
Mouse Description:
NEL-like 2 (chicken) Gene [Source:MGI Symbol;Acc:MGI:1858510]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7538 Missense Mutation detected in F1 DNA During 2017
sa32506 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126863 Missense 123 808 4 36
Genomic Location (Zv9):
Chromosome 25 (position 933139)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 592223
KASP Assay ID:
554-4145.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGCAGGCTGCTGGAGCTGGAGAGCAGTGGGCARAAGAGCGAGGTGC[G/A]TCTCCAYTTCCGGACGGGTCTCCAGCAGACACACACTGAGATTTTCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126863 Nonsense 261 808 7 36
Genomic Location (Zv9):
Chromosome 25 (position 944924)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 604008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGCCAAGACCTCCAGCAAGGTGAACAGCAAACATTCAGACTGTAAT[G/T]AATGCATTAATTGCGGTTCGTCAGCTGGAATGCGAGTGTGAATGACTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link