si:busm1-118j2.5

Ensembl ID:
ENSDARG00000090689
ZFIN IDs:
ZDB-GENE-030131-7722, ZDB-GENE-090501-3
Description:
hypothetical protein LOC793447 [Source:RefSeq peptide;Acc:NP_001096600]
Human Orthologues:
HBB, HBD, HBE1, HBG1, HBG2
Human Descriptions:
hemoglobin, beta [Source:HGNC Symbol;Acc:4827]
hemoglobin, delta [Source:HGNC Symbol;Acc:4829]
hemoglobin, epsilon 1 [Source:HGNC Symbol;Acc:4830]
hemoglobin, gamma A [Source:HGNC Symbol;Acc:4831]
hemoglobin, gamma G [Source:HGNC Symbol;Acc:4832]
Mouse Orthologues:
Gm5736, Hbb-b1, Hbb-b2, Hbb-bh1, Hbb-y
Mouse Descriptions:
hemoglobin beta, bh2 Gene [Source:MGI Symbol;Acc:MGI:96025]
hemoglobin Y, beta-like embryonic chain Gene [Source:MGI Symbol;Acc:MGI:96027]
hemoglobin Z, beta-like embryonic chain Gene [Source:MGI Symbol;Acc:MGI:96024]
hemoglobin, beta adult major chain Gene [Source:MGI Symbol;Acc:MGI:96021]
hemoglobin, beta adult minor chain Gene [Source:MGI Symbol;Acc:MGI:96022]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26160 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128380 Essential Splice Site 31 147 None 3

The following transcripts of ENSDARG00000090689 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 55974484)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54859645
GRCz10 3 54868210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCGCCAAGGCTGACTACGACGTCATCGGTCCTCAGGCTCTGGCAAGG[T/G]AATGAGTCTTGGAGCTTATATTAACTTATATTTATAACATTACATAAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Beta thalassemia/hemoglobin E disease: A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E. (View Study)
  • F-cell distribution: A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15. (View Study)
  • Fetal hemoglobin levels: Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia. (View Study)
  • HbA2 levels: HbA2 levels in normal adults are influenced by two distinct genetic mechanisms. (View Study)
  • Inflammatory biomarkers: A genome-wide association scan on the levels of markers of inflammation in Sardinians reveals associations that underpin its complex regulation. (View Study)
  • Malaria: Genome-wide and fine-resolution association analysis of malaria in West Africa. (View Study)
  • Malaria: Genome-wide association study indicates two novel resistance loci for severe malaria. (View Study)
  • Platelet counts: GWAS of blood cell traits identifies novel associated loci and epistatic interactions in Caucasian and African-American children. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link