LOC559645

Ensembl ID:
ENSDARG00000090686
Human Orthologue:
SLC35F2
Human Description:
solute carrier family 35, member F2 [Source:HGNC Symbol;Acc:23615]
Mouse Orthologue:
Slc35f2
Mouse Description:
solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11796 Nonsense Available for shipment Available now
sa24986 Nonsense Mutation detected in F1 DNA During 2015
sa28457 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa11796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128267 Nonsense 49 332 1 7
Genomic Location:
Chromosome 15 (position 24511798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCTATGCTGCAGAGCTTTAKTAACTACACACTCCTGGGCATCACTTA[C/A]ACCATGGCACTTATCTTCAGAAGAGGTATTTGATCACGAATCATCAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128267 Nonsense 205 332 4 7
Genomic Location:
Chromosome 15 (position 24515463)
KASP Assay ID:
554-7494.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTTTCTGGGGATGGTTGGCCTCTTTGGGTCTATTATCAGCGCAATC[C/T]AACTGTGAGTTTGGTTCTGAAAAATTACAAAATACTCCCTAAAGCGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128267 Nonsense 260 332 6 7
Genomic Location:
Chromosome 15 (position 24519404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGATAAAAAGGAGCAGTGCCACAGCGGTTAACCTTTCCTTACTCACC[G/T]GAGACCTCTTCAGCCTGTTCTTTGGGCTCTTTTTGTTCCATTATAACGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n1dqdvrg