ENSDARG00000090684

Ensembl ID:
ENSDARG00000090684
Human Orthologues:
PRKD1, PRKD2, PRKD3
Human Descriptions:
protein kinase D1 [Source:HGNC Symbol;Acc:9407]
protein kinase D2 [Source:HGNC Symbol;Acc:17293]
protein kinase D3 [Source:HGNC Symbol;Acc:9408]
Mouse Orthologues:
Prkd1, Prkd2, Prkd3
Mouse Descriptions:
protein kinase D1 Gene [Source:MGI Symbol;Acc:MGI:99879]
protein kinase D2 Gene [Source:MGI Symbol;Acc:MGI:2141917]
protein kinase D3 Gene [Source:MGI Symbol;Acc:MGI:1922542]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40833 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124235 Essential Splice Site 281 349 6 8
Genomic Location (Zv9):
Chromosome 7 (position 7674068)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150435.1 26785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTCCGCCTGCTCAAGGGCCTCTTCAGACAGGGCCTGCAGTGCTCCG[G/T]TAAGAAACACTCATGCACACTTACTGACAGCAGGTGTGTTTACACTGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link