ENSDARG00000090665

Ensembl ID:
ENSDARG00000090665
Human Orthologues:
GPR114, GPR56, GPR97
Human Descriptions:
G protein-coupled receptor 114 [Source:HGNC Symbol;Acc:19010]
G protein-coupled receptor 56 [Source:HGNC Symbol;Acc:4512]
G protein-coupled receptor 97 [Source:HGNC Symbol;Acc:13728]
Mouse Orthologues:
Gpr114, Gpr56, Gpr97
Mouse Descriptions:
G protein-coupled receptor 114 Gene [Source:MGI Symbol;Acc:MGI:2685955]
G protein-coupled receptor 56 Gene [Source:MGI Symbol;Acc:MGI:1340051]
G protein-coupled receptor 97 Gene [Source:MGI Symbol;Acc:MGI:1859670]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30423 Nonsense Mutation detected in F1 DNA During 2017
sa38177 Nonsense Mutation detected in F1 DNA During 2017
sa44403 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128479 Nonsense 294 810 8 18
Genomic Location (Zv9):
Chromosome Zv9_NA277 (position 27851)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1273520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACTACCAGTTCAACACAACACATCACACCTACCCAGTCAAACCCTTA[T/G]ACAACTGCAGTTAGTACTGTCAGTAAACCGGAGATGATGGTAAACATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128479 Nonsense 418 810 10 18
Genomic Location (Zv9):
Chromosome Zv9_NA277 (position 24561)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1270230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGCCTTTGATAAATCAAGTCTGGAAAACAATGGAAGTGCTTTTGTT[G/T]GAGTTTTGCGGTACCCAAACATGGTTAAAGAGGTTTGCTTCTGTTTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128479 Nonsense 614 810 15 18
Genomic Location (Zv9):
Chromosome Zv9_NA277 (position 23364)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1269033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCTGATGCATTACTCCATGCTGACGTCATTCACCTGGTTCTTCATT[C/T]AAGCTCTTCATATGTACTTATGGCTCATCCGACAGAACGTCACCATCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link