C17orf104

Ensembl ID:
ENSDARG00000090664
Description:
chromosome 17 open reading frame 104 [Source:HGNC Symbol;Acc:26670]
Human Orthologue:
C17orf104
Human Description:
chromosome 17 open reading frame 104 [Source:HGNC Symbol;Acc:26670]
Mouse Orthologue:
Gm1564
Mouse Description:
predicted gene 1564 Gene [Source:MGI Symbol;Acc:MGI:2686410]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15914 Nonsense Available for shipment Available now
sa9789 Nonsense Available for shipment Available now
sa25251 Nonsense Mutation detected in F1 DNA During 2014
sa17841 Nonsense Available for shipment Available now
sa13122 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 110 851 4 8
Genomic Location:
Chromosome 3 (position 31754669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAWAATTGTGGCAGTGAGGCTGATCTTTATGGATTAGTGTCAGATATCT[T/A]GGATGAACCAGATTCAGTGGACCCCTACCCCTCMTATGAGAAGTAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 249 851 5 8
Genomic Location:
Chromosome 3 (position 31752082)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGACAAAGAAGAAGGATACTTTAACCCCAMTAACTCCACATCTGATTA[T/G]ATAAACACGGCCAACTCCTATTATTCTTCTCAAAATTCAGATGACTCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 321 851 5 8
Genomic Location:
Chromosome 3 (position 31751866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTACTGCAAAGAACCAACCCAGAATGGGTTTTTAACGCAGAGGAACTA[T/G]GAAGAAATCATGGCAGAGCAGAAAAGTCATCCTTTTCAAAGGATGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 322 851 5 8
Genomic Location:
Chromosome 3 (position 31751865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTACTGCAAAGAACCAACCCAGAATGGGTTTTTAACGCAGAGGAACTAT[G/T]AAGAAATCATGKCAGAGCAGAAAAGTCATCCTTTTCAAAGGATGTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124559 Nonsense 421 851 5 8
Genomic Location:
Chromosome 3 (position 31751568)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAATGGRAAGTGGCATAACTCAAACCAGTGTTAATCTCTTTCACCCACTC[C/T]AGCCAAACCATTGTCAAATCCAAGCAAAKATTCCAGCAAAAACCAGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j4qjgm84