LOC100334126

Ensembl ID:
ENSDARG00000090659
Human Orthologue:
SGCZ
Human Description:
sarcoglycan, zeta [Source:HGNC Symbol;Acc:14075]
Mouse Orthologue:
Sgcz
Mouse Description:
sarcoglycan zeta Gene [Source:MGI Symbol;Acc:MGI:2388820]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18691 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130418 Essential Splice Site 72 295 2 9
Genomic Location:
Chromosome 1 (position 14523698)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTTAGCGTTGACCATCTGGATTCTAAAAGTCATGAACTTCACTGTGG[T/G]AAGCACTTCTCTGTCTCCTGTTGTTTTCCTCTGTTTATTGTCTATATTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u9ksiv2n