LOC100334126

Ensembl ID:
ENSDARG00000090659
Human Orthologue:
SGCZ
Human Description:
sarcoglycan, zeta [Source:HGNC Symbol;Acc:14075]
Mouse Orthologue:
Sgcz
Mouse Description:
sarcoglycan zeta Gene [Source:MGI Symbol;Acc:MGI:2388820]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18691 Essential Splice Site Mutation detected in F1 DNA During 2015
sa25550 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa18691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130418 Essential Splice Site 72 295 2 9
Genomic Location:
Chromosome 1 (position 14523698)
KASP Assay ID:
2259-0350.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTTAGCGTTGACCATCTGGATTCTAAAAGTCATGAACTTCACTGTGG[T/G]AAGCACTTCTCTGTCTCCTGTTGTTTTCCTCTGTTTATTGTCTATATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130418 Essential Splice Site 201 295 6 9
Genomic Location:
Chromosome 1 (position 14408778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCAGTGGAAACGCCACACGTTCGAGCTGAACCATTCCAAGACCTGAA[G/A]TAAGGCATGCTTTCTTAATGTATCACATTATCATTCAGTGTGTGATTCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u9ksiv2n