ch1073-321c8.1

Ensembl ID:
ENSDARG00000090656
ZFIN IDs:
ZDB-GENE-040426-1976, ZDB-GENE-081028-53
Description:
translocase of outer mitochondrial membrane 20 homolog a [Source:RefSeq peptide;Acc:NP_998201]
Human Orthologue:
ARID4B
Human Description:
AT rich interactive domain 4B (RBP1-like) [Source:HGNC Symbol;Acc:15550]
Mouse Orthologue:
Arid4b
Mouse Description:
AT rich interactive domain 4B (RBP1-like) Gene [Source:MGI Symbol;Acc:MGI:2137512]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16991 Essential Splice Site Available for shipment Available now
sa22385 Nonsense Mutation detected in F1 DNA During 2014
sa11972 Essential Splice Site Available for shipment Available now
sa11502 Essential Splice Site Available for shipment Available now
sa13629 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028457 None None 145 None 5
ENSDART00000128415 Essential Splice Site 150 1249 6 28
ENSDART00000148083 Essential Splice Site 148 387 5 12
Genomic Location:
Chromosome 13 (position 50653193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTCATCGGCAARAAGRGAAACCGCGGCGGWCGRCGCTCCAACCCCAT[G/A]TGAGTGCCTGTGYGATTGTGTGTGTGTGTGTGTKTGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028457 None None 145 None 5
ENSDART00000128415 Nonsense 225 1249 9 28
ENSDART00000148083 Nonsense 223 387 8 12
Genomic Location:
Chromosome 13 (position 50646284)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGATGGTATGATTTAATGCATACCGTGTTGTGTTATGTCCTACAGTTA[T/A]ACAGTTTTACGGAAAGATATTCGAGAGTTGGATGAAGATAAAGCTCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028457 None None 145 None 5
ENSDART00000128415 Essential Splice Site 355 1249 12 28
ENSDART00000148083 Essential Splice Site 353 387 11 12
Genomic Location:
Chromosome 13 (position 50638484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTTCAAGCTCTACAGGCTGGTGCATAAGCTGGGAGGATTCGACAAT[G/T]WGAGTGAAACACGGTCTCAATCATTNNNNGGAAAATAAAGATTTAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028457 None None 145 None 5
ENSDART00000128415 Essential Splice Site 355 1249 12 28
ENSDART00000148083 Essential Splice Site 353 387 11 12
Genomic Location:
Chromosome 13 (position 50638483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTTCAAGCTCTACAGGCTGGTGCATAAGCTGGGAGGATTCGACAATK[T/A]GAGTGAAACACGGTCTCAATCATTNNNNGGAAAATAAAGATTTAAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028457 None None 145 None 5
ENSDART00000128415 Essential Splice Site 355 1249 12 28
ENSDART00000148083 Essential Splice Site 353 387 11 12
Genomic Location:
Chromosome 13 (position 50638483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTTCAAGCTCTACAGGCTGGTGCATAAGCTGGGAGGATTCGACAATK[T/A]GAGTGAAACACGGTCTCAATCATTNNNNGGAAAATAAAGATTTAAATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pn0uhtqn