ENSDARG00000090648

Ensembl ID:
ENSDARG00000090648
Human Orthologues:
ABCA1, ABCA7
Human Descriptions:
ATP-binding cassette, sub-family A (ABC1), member 1 [Source:HGNC Symbol;Acc:29]
ATP-binding cassette, sub-family A (ABC1), member 7 [Source:HGNC Symbol;Acc:37]
Mouse Orthologues:
Abca1, Abca7
Mouse Descriptions:
ATP-binding cassette, sub-family A (ABC1), member 1 Gene [Source:MGI Symbol;Acc:MGI:99607]
ATP-binding cassette, sub-family A (ABC1), member 7 Gene [Source:MGI Symbol;Acc:MGI:1351646]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34257 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122874 Essential Splice Site 119 331 4 8
Genomic Location (Zv9):
Chromosome 7 (position 76214808)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72987529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTATTACAAAATAAAGTATTTGATGTATTGTGTATGTGTGTGTTTCA[G/A]TGTAACTACATCGTCCCGTGTGTGATCGTCATCATCATCTTCCTCTGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Alzheimer's disease: Common variants at ABCA7, MS4A6A/MS4A4E, EPHA1, CD33 and CD2AP are associated with Alzheimer's disease. (View Study)
  • Alzheimer's disease (late onset): Common variants at MS4A4/MS4A6E, CD2AP, CD33 and EPHA1 are associated with late-onset Alzheimer's disease. (View Study)
  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)
  • Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)
  • Metabolite levels: Genome-wide association study identifies multiple loci influencing human serum metabolite levels. (View Study)
  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Total ventricular volume: Genome-wide association with MRI atrophy measures as a quantitative trait locus for Alzheimer's disease. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link