LOC100331956

Ensembl ID:
ENSDARG00000090644
Human Orthologue:
COL21A1
Human Description:
collagen, type XXI, alpha 1 [Source:HGNC Symbol;Acc:17025]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30321 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130646 Essential Splice Site 68 223 2 5
Genomic Location (Zv9):
Chromosome Zv9_scaffold3454 (position 13824)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1728530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAATGTCTGAGCAGCACATCCAGCAGATCTGCAGAGACATCCTCCGAT[G/A]TGAGTACACATAAGTATCTCCAATATTTTTCATTATCATAATTTTTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link