myh6

Ensembl ID:
ENSDARG00000090637
ZFIN ID:
ZDB-GENE-031112-1
Description:
myosin-7 [Source:RefSeq peptide;Acc:NP_942118]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6659 Nonsense Mutation detected in F1 DNA During 2014
sa25148 Nonsense Mutation detected in F1 DNA During 2014
sa12893 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126983 Nonsense 980 1936 1 1
Genomic Location:
Chromosome 20 (position 53930300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTAGAAAAGGAAAAGCATGCTACTGAGAACAAAGTGAAGAATATTACC[G/T]AAGAAATGGCATCTCTTGATGAAAAYATAATGAAACTCACCAAGGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126983 Nonsense 1074 1936 1 1
Genomic Location:
Chromosome 20 (position 53930582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGTCAAACTGACTCAAGAAAATGTAATGGACTTAGAAAACGACAAA[C/T]AGCAACTGGAGGACAAGCTCAAGAAGAAAGACTTTGAGATCAATCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126983 Nonsense 1585 1936 1 1
Genomic Location:
Chromosome 20 (position 53932115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCRAGRCAGATTTCGAGCGCAAGATGTCTGAGAAGGATGAAGAAATGGAG[C/T]AAGCGAGGAGAAACTATCAGCGTATGATTGAATCCTTGCAAGCCTCTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dq3xgn77