si:ch211-244h7.5

Ensembl ID:
ENSDARG00000090635
ZFIN ID:
ZDB-GENE-050420-186
Description:
hypothetical protein LOC569191 [Source:RefSeq peptide;Acc:NP_001038643]
Human Orthologue:
KCNJ1
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 1 [Source:HGNC Symbol;Acc:6255]
Mouse Orthologue:
Kcnj1
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 1 Gene [Source:MGI Symbol;Acc:MGI:1927248

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa385 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122189 Nonsense 91 368 1 1
ENSDART00000133364 Nonsense 91 368 2 2
Genomic Location (Zv9):
Chromosome 18 (position 47071522)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48513213
KASP Assay ID:
554-0187.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTTCGGACTCTTGTGGTACTGGTTAGCAAGAAGCAATGGTGACCTGT[T/A]GTGGCAGAATCCACCACCAGATCACAACCCATGCGCTTACAGCCTTAATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link