PDZD7 (2 of 2)

Ensembl ID:
ENSDARG00000090631
Description:
PDZ domain containing 7 [Source:HGNC Symbol;Acc:26257]
Human Orthologue:
PDZD7
Human Description:
PDZ domain containing 7 [Source:HGNC Symbol;Acc:26257]
Mouse Orthologue:
Pdzd7
Mouse Description:
PDZ domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:3608325]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42097 Nonsense Mutation detected in F1 DNA During 2017
sa24924 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123407 Nonsense 34 864 2 21
Genomic Location (Zv9):
Chromosome 12 (position 49023589)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47900091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGGTCCTCAGAGGTGATGATGGTCAGCTGGGCTTCAGTGTGCGAGGA[G/T]GATCTGAACACGGACTCAGTGTCTTCATCAGCAAAGTACAGAAAAACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123407 Nonsense 723 864 19 21
Genomic Location (Zv9):
Chromosome 12 (position 49000331)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47876833
KASP Assay ID:
554-7875.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAGAGAGTCCTGAAGACGACGTGCTGTTCACTGTAGTGGACGCTCCT[C/T]GACACAAGAGGCCGCTGCTGGCTCAGGTCTTCGGCTCTATGAAAAAATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link