C10orf112

Ensembl ID:
ENSDARG00000090618
Description:
chromosome 10 open reading frame 112 [Source:HGNC Symbol;Acc:24331]
Human Orthologue:
C10orf112
Human Description:
chromosome 10 open reading frame 112 [Source:HGNC Symbol;Acc:24331]
Mouse Orthologue:
Gm13318
Mouse Description:
predicted gene 13318 Gene [Source:MGI Symbol;Acc:MGI:3651283]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31588 Essential Splice Site Available for shipment Available now
sa40980 Nonsense Mutation detected in F1 DNA During 2016
sa8852 Nonsense Mutation detected in F1 DNA During 2016
sa34149 Nonsense Mutation detected in F1 DNA During 2016
sa18339 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121509 Essential Splice Site 33 1473 1 26
Genomic Location (Zv9):
Chromosome 7 (position 44414468)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41404768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTAGTCCCACATTCCAGCAAAGCGGTTCAGATTGTGTCATGACCTTCTG[G/A]TAAGGACTGTAGAAATTGGTGACTGGAGGCCCAGACCTGACATCTAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121509 Nonsense 212 1473 3 26
Genomic Location (Zv9):
Chromosome 7 (position 44413470)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41403770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGGAAGGATCACACACGAGCCAGTGCAGATGGGCACTTCCTCTATATC[G/T]AATCTTCAGACCCTCAGAAGTTCAAAGACACTGCCGTTCTGATCAGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121509 Nonsense 654 1473 10 26
Genomic Location (Zv9):
Chromosome 7 (position 44403711)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41394011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCATCCACTGACCACACCCTCCGCAACCCATCAGGCCACTACTTGTA[T/A]CTAGAAGGGTCCTTTCCGCAGACAACTGGACATWCYGCCAGAATCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121509 Nonsense 1306 1473 20 26
Genomic Location (Zv9):
Chromosome 7 (position 44375234)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41365534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCAGACTGTGTGGCGTATCAGAATCGATGTGATGATATTGTTGACTG[T/A]CCTCCGTTTAACTCTGATGAGTCCAGCTGCTTTGGTAACACAAACACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121509 Essential Splice Site 1401 1473 23 26
Genomic Location (Zv9):
Chromosome 7 (position 44370715)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41361015
KASP Assay ID:
2259-9341.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACGGGAGTCGTTTTGTTCTGGTTRTTTCAAAAGAGGCATTCGCTAAA[G/T]TAAGTCCATTTACATTCAGATGAACTCCACATAATCAGAACGTGTCCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link