C10orf112

Ensembl ID:
ENSDARG00000090618
Description:
chromosome 10 open reading frame 112 [Source:HGNC Symbol;Acc:24331]
Human Orthologue:
C10orf112
Human Description:
chromosome 10 open reading frame 112 [Source:HGNC Symbol;Acc:24331]
Mouse Orthologue:
Gm13318
Mouse Description:
predicted gene 13318 Gene [Source:MGI Symbol;Acc:MGI:3651283]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8852 Nonsense Mutation detected in F1 DNA During 2014
sa18339 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121509 Nonsense 654 1473 10 26
Genomic Location:
Chromosome 7 (position 44403711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCATCCACTGACCACACCCTCCGCAACCCATCAGGCCACTACTTGTA[T/A]CTAGAAGGGTCCTTTCCGCAGACAACTGGACATWCYGCCAGAATCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121509 Essential Splice Site 1401 1473 23 26
Genomic Location:
Chromosome 7 (position 44370715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACGGGAGTCGTTTTGTTCTGGTTRTTTCAAAAGAGGCATTCGCTAAA[G/T]TAAGTCCATTTACATTCAGATGAACTCCACATAATCAGAACGTGTCCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oigwemy1