KIAA0427

Ensembl ID:
ENSDARG00000090617
Description:
KIAA0427 [Source:HGNC Symbol;Acc:23925]
Human Orthologue:
KIAA0427
Human Description:
KIAA0427 [Source:HGNC Symbol;Acc:23925]
Mouse Orthologue:
Gm672
Mouse Description:
predicted gene 672 Gene [Source:MGI Symbol;Acc:MGI:2685518]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16318 Nonsense Available for shipment Available now
sa8419 Nonsense Mutation detected in F1 DNA During 2014
sa18327 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127740 Nonsense 167 647 5 12
Genomic Location:
Chromosome 21 (position 3493293)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCGACGTGGGACATGCAGCCGGAGAAGCTGGATTTYTCTCAGTTTCAC[C/T]GAAGGCCTTTCAGAGGRACACCGAAACACCTGCCGCACATCGACAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127740 Nonsense 279 647 8 12
Genomic Location:
Chromosome 21 (position 3536561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAAGGACTTCCGCCGYCGCAGCAGAATCAGMCGACCAATCAGACGCAA[C/T]AGCCCAACTCAGACCACCAATCAGGAGCTGGCTTGAAACAAAGTGGGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127740 Nonsense 505 647 9 12
Genomic Location:
Chromosome 21 (position 3539641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTTCATGGTGGAGGGAACCAAATTCCGCTCACTCCTACTCAACATGT[T/A]ACAGGTGAGAACCAAACAAACTATCACTATTTTTTWAAGTWGTCAAACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mkqtao4h