LOC100334642

Ensembl ID:
ENSDARG00000090611
Human Orthologue:
CASKIN1
Human Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Mouse Orthologue:
Caskin1
Mouse Description:
CASK interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442952]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38219 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44427 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130451 Essential Splice Site 139 352 4 9
Genomic Location (Zv9):
Chromosome Zv9_NA86 (position 56229)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150646.1 56229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTAAGAAGACTCCTCTGGATCTGGCCTGTGAGTTCGGCCGAGCGAAG[G/A]TCAGTAGTTTCAGCTGTGATGCGTCCTAATATCAGTGTTTATCTTCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130451 Essential Splice Site 287 352 8 9
Genomic Location (Zv9):
Chromosome Zv9_NA86 (position 72436)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31737531
GRCz10 KN150646.1 72436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCACGACCCCACAGCCCTCACCATACGGGCCGGAGACGTCATCACG[G/T]TACAGACGCTTGCACTACACAATCTTAATATAGGGTCGGTGTGTGTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link