SH2D6

Ensembl ID:
ENSDARG00000090607
Description:
SH2 domain containing 6 [Source:HGNC Symbol;Acc:30439]
Human Orthologue:
SH2D6
Human Description:
SH2 domain containing 6 [Source:HGNC Symbol;Acc:30439]
Mouse Orthologue:
Sh2d6
Mouse Description:
SH2 domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1918380]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15320 Essential Splice Site Available for shipment Available now
sa34277 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124093 Essential Splice Site 8 147 2 6
Genomic Location (Zv9):
Chromosome 8 (position 2299861)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2067834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTTAAAAATCTTACACACTTAAATATATATATACTTGTTCTGTTTCC[A/T]GTCCCCCTACTCCTCCATCTCTGGACAKCACAGGTCAGCACAGGTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124093 Essential Splice Site 57 147 4 6
Genomic Location (Zv9):
Chromosome 8 (position 2299531)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2067504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATTGTGACCGTAAGACTGCTGAGGAAACTGTGCTCCGGATGAACAAG[G/A]TTTGTGTGCGTTTATGTGTGATTTGTTTTTTTTTTTTGTATTGTCATGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link