CUL3 (2 of 2)

Ensembl ID:
ENSDARG00000090602
Description:
cullin 3 [Source:HGNC Symbol;Acc:2553]
Human Orthologue:
CUL3
Human Description:
cullin 3 [Source:HGNC Symbol;Acc:2553]
Mouse Orthologue:
Cul3
Mouse Description:
cullin 3 Gene [Source:MGI Symbol;Acc:MGI:1347360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39021 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125379 Nonsense 73 543 2 11
Genomic Location (Zv9):
Chromosome 15 (position 1765478)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1805363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGGAACGCCTACACCATGGTCCTGCACAAACACGGAGAGAAGCTCTA[T/A]ACAGGCCTGAGGGAGGTGGTCACAGAACATCTAATCAACAAAGTAAGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link