ENSDARG00000090599

Ensembl ID:
ENSDARG00000090599
Human Orthologues:
CD300A, CD300C, CD300E, CD300LB, CD300LD, CD300LF
Human Descriptions:
CD300 molecule-like family member b [Source:HGNC Symbol;Acc:30811]
CD300 molecule-like family member d [Source:HGNC Symbol;Acc:16848]
CD300 molecule-like family member f [Source:HGNC Symbol;Acc:29883]
CD300a molecule [Source:HGNC Symbol;Acc:19319]
CD300c molecule [Source:HGNC Symbol;Acc:19320]
CD300e molecule [Source:HGNC Symbol;Acc:28874]
Mouse Orthologues:
AF251705, Cd300a, Cd300c, Cd300e, Cd300lb, Cd300ld, Cd300lf, Clm3, Gm11709, Gm11709, Gm11711
Mouse Descriptions:
CD300 antigen like family member B Gene [Source:MGI Symbol;Acc:MGI:2685099]
CD300 antigen like family member F Gene [Source:MGI Symbol;Acc:MGI:2442359]
CD300 molecule-like family member d Gene [Source:MGI Symbol;Acc:MGI:2442358]
CD300A antigen Gene [Source:MGI Symbol;Acc:MGI:2443411]
CD300C antigen Gene [Source:MGI Symbol;Acc:MGI:3032626]
CD300e antigen Gene [Source:MGI Symbol;Acc:MGI:2387602]
cDNA sequence AF251705 Gene [Source:MGI Symbol;Acc:MGI:2153249]
CMRF-35-like molecule 3 Gene [Source:MGI Symbol;Acc:MGI:2687214]
predicted gene 11709 Gene [Source:MGI Symbol;Acc:MGI:3649405]
predicted gene 11709 Gene [Source:MGI Symbol;Acc:MGI:3649405]
predicted gene 11711 Gene [Source:MGI Symbol;Acc:MGI:3702661]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19626 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123618 Essential Splice Site 368 389 12 13
Genomic Location:
Chromosome 1 (position 58515462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCGCTGTTTACGCCACTGCTCAATTACCCACAAACCCCTCTGATTCCT[G/T]TATTTACTCAACAGTTCAGGAAGCCTCTGGTGACTCTCAGATCTGCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1v1o6tb7