LOC795138

Ensembl ID:
ENSDARG00000090579

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23687 Nonsense Mutation detected in F1 DNA During 2014
sa12317 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122546 Nonsense 159 2322 2 2
Genomic Location:
Chromosome 20 (position 23183098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAATCTTGCCAAAAAATCCTGCTGTAAGGGTAGGGTCAAGAACAGAGT[C/A]AGAATTTATTCTTGCCGTCTGCCTGTCGGTCATAATTACATTCATTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122546 Nonsense 2298 2322 2 2
Genomic Location:
Chromosome 20 (position 23189514)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AMAATTCCAGAAGCACAGAAGGAGTGGAAGCCCCAGTTTTGCGRGGACTT[A/T]AAACAAAGAGTACATCAACACTTGACTCTAAGTCACCAGCAAATTCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fycmr8hn