MRPL52

Ensembl ID:
ENSDARG00000090568
Description:
mitochondrial ribosomal protein L52 [Source:HGNC Symbol;Acc:16655]
Human Orthologue:
MRPL52
Human Description:
mitochondrial ribosomal protein L52 [Source:HGNC Symbol;Acc:16655]
Mouse Orthologue:
Mrpl52
Mouse Description:
mitochondrial ribosomal protein L52 Gene [Source:MGI Symbol;Acc:MGI:1916086]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8267 Nonsense Mutation detected in F1 DNA During 2014
sa13103 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127177 Nonsense 45 127 3 5
Genomic Location:
Chromosome 7 (position 25283694)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCCTGTTTTGTTTGTAGAAATGGTTTACCACGTGGTGGATCAGAGTA[C/A]GGACCATTAACAGATCTACCTGACTGGTCATTTGCAGGTGAACATTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127177 Nonsense 75 127 4 5
Genomic Location:
Chromosome 7 (position 25283975)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTAGGCCTGCACCACTGCTCAAAGGACAGATMCGCAGACAAAAGCAA[C/T]GAGAGGAGTTTGCTGTAAGASTTMTAAAATGTTGTATTTGTTTCCTGWTR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nm3hay39