si:ch73-162j3.4

Ensembl ID:
ENSDARG00000090564
ZFIN ID:
ZDB-GENE-090313-136
Human Orthologue:
PDZD4
Human Description:
PDZ domain containing 4 [Source:HGNC Symbol;Acc:21167]
Mouse Orthologue:
Pdzd4
Mouse Description:
PDZ domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2443483]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43893 Nonsense Mutation detected in F1 DNA During 2017
sa43894 Nonsense Mutation detected in F1 DNA During 2017
sa31076 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004678 Nonsense 426 821 7 7
ENSDART00000138198   None 78 None 3

The following transcripts of ENSDARG00000090564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 261423)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 232414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGAAGCATCCCTGTCGATATGAACTGCAACGAGAGTTTGATGCAGCAC[G/T]AAATCGCTCTTCTGGATGAGGAAATACGACATCTGGAGTTTAAATGGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004678 Nonsense 686 821 7 7
ENSDART00000138198   None 78 None 3
ENSDART00000004678 Nonsense 686 821 7 7
ENSDART00000138198   None 78 None 3

The following transcripts of ENSDARG00000090564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 262205)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 233196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCTAGGATGGAGTGGAAGGTGAAGATCCGCAGCGATGGCTCAAGGTA[C/A]GTGGCTAAACGCCCTGTAAGAGATCGTCTGCTGAAGGCTCGTGCCATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004678 Nonsense 686 821 7 7
ENSDART00000138198   None 78 None 3
ENSDART00000004678 Nonsense 686 821 7 7
ENSDART00000138198   None 78 None 3

The following transcripts of ENSDARG00000090564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 262205)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 233196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCTAGGATGGAGTGGAAGGTGAAGATCCGCAGCGATGGCTCAAGGTA[C/A]GTGGCTAAACGCCCTGTAAGAGATCGTCTGCTGAAGGCTCGTGCCATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link