si:dkey-102m7.1

Ensembl ID:
ENSDARG00000090527
ZFIN ID:
ZDB-GENE-091118-76
Human Orthologue:
FHDC1
Human Description:
FH2 domain containing 1 [Source:HGNC Symbol;Acc:29363]
Mouse Orthologue:
Fhdc1
Mouse Description:
FH2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2684972]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7389 Missense Mutation detected in F1 DNA During 2017
sa42377 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121612 Missense 209 916 5 11
ENSDART00000141628 Missense 209 916 6 12

The following transcripts of ENSDARG00000090527 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18718943)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14513396
KASP Assay ID:
554-4321.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCATCATCATCATGTGCAGCTTTCGCATGCGCCTGGACGTCATGATTC[T/A]CCAGCAGGAGTTTGACCCAGCTGTAACCTCTCTCTGTGTGGCGGCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121612 Nonsense 758 916 11 11
ENSDART00000141628 Nonsense 758 916 12 12

The following transcripts of ENSDARG00000090527 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18727189)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14521642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGGTAAAATCACCCACTCGAGGACCCACCAAAAGACTTCTGGTGCCC[C/T]GAGGAGGACCTTCCAACAGCAGTGGAATTCCAAGAGTACGCACAAAGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link