ENSDARG00000090525

Ensembl ID:
ENSDARG00000090525
Human Orthologues:
ADCY2, ADCY4, ADCY7
Human Descriptions:
adenylate cyclase 2 (brain) [Source:HGNC Symbol;Acc:233]
adenylate cyclase 4 [Source:HGNC Symbol;Acc:235]
adenylate cyclase 7 [Source:HGNC Symbol;Acc:238]
Mouse Orthologues:
Adcy2, Adcy4, Adcy7
Mouse Descriptions:
adenylate cyclase 2 Gene [Source:MGI Symbol;Acc:MGI:99676]
adenylate cyclase 4 Gene [Source:MGI Symbol;Acc:MGI:99674]
adenylate cyclase 7 Gene [Source:MGI Symbol;Acc:MGI:102891]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33991 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130657 Nonsense 172 289 5 7
Genomic Location (Zv9):
Chromosome 7 (position 772522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAGAGTTCCTCCTAGAAAAGTGTTTCAAGAAGAAGTCAGAGGAAATG[G/T]AGACGACGAAGAACGTGAACCGCCTGCTGCTGCAGAATCTGCTGCCCGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link