ENSDARG00000090514

Ensembl ID:
ENSDARG00000090514
Human Orthologue:
MYOM2
Human Description:
myomesin (M-protein) 2, 165kDa [Source:HGNC Symbol;Acc:7614]
Mouse Orthologue:
Myom2
Mouse Description:
myomesin 2 Gene [Source:MGI Symbol;Acc:MGI:1328358]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30368 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130478 Essential Splice Site 165 345 5 9
Genomic Location (Zv9):
Chromosome Zv9_scaffold3535 (position 30599)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6842317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGATGCTGAGAAAACCCACACTCGTACCCTGGATCTTTCTGGACAACG[T/C]GAGTTGTTTGAATGTGTCACTTCTTAATATGAAGCTTAAGCTTTTTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link