ENSDARG00000090501

Ensembl ID:
ENSDARG00000090501
Human Orthologues:
ART1, ART3, ART4, ART5
Human Descriptions:
ADP-ribosyltransferase 1 [Source:HGNC Symbol;Acc:723]
ADP-ribosyltransferase 3 [Source:HGNC Symbol;Acc:725]
ADP-ribosyltransferase 4 (Dombrock blood group) [Source:HGNC Symbol;Acc:726]
ADP-ribosyltransferase 5 [Source:HGNC Symbol;Acc:24049]
Mouse Orthologues:
Art1, Art2b, Art3, Art4, Art5
Mouse Descriptions:
ADP-ribosyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:107511]
ADP-ribosyltransferase 2b Gene [Source:MGI Symbol;Acc:MGI:107545]
ADP-ribosyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1202729]
ADP-ribosyltransferase 4 Gene [Source:MGI Symbol;Acc:MGI:1202710]
ADP-ribosyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:107948]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12203 Nonsense Available for shipment Available now
sa19951 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126888 Nonsense 55 226 1 3
Genomic Location (Zv9):
Chromosome 3 (position 10193323)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 9543550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACTCGGAARAATTCAGAASAGCTTGGRAAAAAGGGGAAGATTTTGTC[A/T]AGRACCAAGYTGATAGYTTGACRAGAAATAATTTAATTGCAATTTATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126888 Nonsense 112 226 2 3
Genomic Location (Zv9):
Chromosome 3 (position 10193509)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 9543364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCATTTCACTTTCTGTTGACTGAAGCGGTTCAGGTTTTGAAGAAAACA[C/T]AAAAGAAATGCTTTTCAACTTTTCGTGGAACTAAAATTGAGTTTAACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link