LOC100001503

Ensembl ID:
ENSDARG00000090496
Human Orthologue:
THSD7A
Human Description:
thrombospondin, type I, domain containing 7A [Source:HGNC Symbol;Acc:22207]
Mouse Orthologue:
Thsd7a
Mouse Description:
thrombospondin, type I, domain containing 7A Gene [Source:MGI Symbol;Acc:MGI:2685683]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16268 Nonsense Available for shipment Available now
sa7814 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15789 Nonsense Available for shipment Available now
sa22945 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Nonsense 1051 1648 15 29
Genomic Location:
Chromosome 16 (position 50340522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAATGGTCAAACTGGTCACGCTGCAGTAAATCCTGYGGCAGTGGTGTT[A/T]AAGTTCGCTCAAAATGGCTCAGAGAAAAGCCTTACAAYGGAGGAAGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Essential Splice Site 1174 1648 18 29
Genomic Location:
Chromosome 16 (position 50348666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGACTGTGTGCTGTCTGAATGGAGCCGTTGGACCTYCTGTGACCTGG[T/A]CAGCATTCATCCTTTATACCAGGGGTCTCCAATCTYRGTCCTGGAGGGCM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Nonsense 1191 1648 19 29
Genomic Location:
Chromosome 16 (position 50352274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGTGCACTGGAAGAGGAGATCGGGAGAGGAYGGCGTTCGCTCTGCGTT[T/A]GCCTAAAGAGGGAGAGGACTGTCCTGTCAGCATGCAGACYGAGCCCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110471 Nonsense 1583 1648 27 29
Genomic Location:
Chromosome 16 (position 50381790)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCCACCCTGCCCACCACTGTACAGCCTGGACGCGTCGGACGCACGTG[G/A]TACTTACAGCCTTTTGGAGCAGGTAAACGTGTTTCACTTCTGTTAGCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/790i642a