ttll10

Ensembl ID:
ENSDARG00000090472
ZFIN ID:
ZDB-GENE-081104-350
Human Orthologue:
TTLL10
Human Description:
tubulin tyrosine ligase-like family, member 10 [Source:HGNC Symbol;Acc:26693]
Mouse Orthologue:
Ttll10
Mouse Description:
tubulin tyrosine ligase-like family, member 10 Gene [Source:MGI Symbol;Acc:MGI:1921855]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24322 Nonsense Mutation detected in F1 DNA During 2014
sa24323 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127737 Nonsense 98 665 2 11
ENSDART00000139710 Nonsense 98 600 3 12

The following transcripts of ENSDARG00000090472 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 24376518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTGTTGAGAAGGACATAGACAGGCGTCCTGAAGAGCCACGGGGCCCT[G/T]GACCCTTCTTCTTTTTTGGTGGAAAAAATGGGGCCTCCATGTGAGTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127737 Nonsense 585 665 11 11
ENSDART00000139710 Nonsense 585 600 12 12

The following transcripts of ENSDARG00000090472 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 24400041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACAATCTGCTACAGCAGTTGTATTCCAGAAACCTCTTTTAAAGTTT[C/T]AAGAAATGAAGCAATCCAAACCAGTCCGTGTGGAGCTGCAGCTCAGCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c11bizcf