PPP1R3A (2 of 2)

Ensembl ID:
ENSDARG00000090468
Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3A [Source:HGNC Symbol;Acc:9291]
Human Orthologue:
PPP1R3A
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3A [Source:HGNC Symbol;Acc:9291]
Mouse Orthologue:
Ppp1r3a
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3A Gene [Source:MGI Symbol;Acc:MGI:2153588]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20199 Nonsense Available for shipment Available now
sa33377 Nonsense Mutation detected in F1 DNA During 2017
sa33378 Nonsense Mutation detected in F1 DNA During 2017
sa20200 Nonsense Available for shipment Available now
sa33379 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122574 Nonsense 132 1426 1 4
Genomic Location (Zv9):
Chromosome 4 (position 5961857)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6564401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCGAGGAATCGTCCGAGTGCTTAACTTATGCTTCCACAAATCAGTTTA[T/A]GTCCGTGTTACACTGGACGGCTGGCAGAGTCACTTTGAGCTGATGGCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122574 Nonsense 612 1426 4 4
Genomic Location (Zv9):
Chromosome 4 (position 5966677)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6569221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTGCTGACAGGAGAGCAATAGAAACCATAAAATCTGATCCCACGGAG[C/T]AAGGAAAGAATCTGAGCACAGGTCTTTCGAGTGATCAAGTTGTTGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122574 Nonsense 815 1426 4 4
Genomic Location (Zv9):
Chromosome 4 (position 5967286)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6569830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGGATGGAGGAGCTGAAAAAGGCTACATTCTAGGGTCTGGTGACAGG[A/T]GAGCAATAGAAATCATAAAATCTGATCCCACAGAGCAAGGAAAGGATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122574 Nonsense 990 1426 4 4
Genomic Location (Zv9):
Chromosome 4 (position 5967811)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6570355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCACAAGTCTTACTAGAGATCAAGATGTGGATTACCGGTTAGTAAAA[G/T]AATCAAAAGCCACTACCGTACCGTGCTTTGCTTTAGCTTCAAGGGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122574 Nonsense 1244 1426 4 4
Genomic Location (Zv9):
Chromosome 4 (position 5968573)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6571117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGTGCGCGAGCGAGGCGTTTAATGAGAACGAATTATGCACGATGAAC[A/T]AGAATCTTCACAAAGACAATTCAGAGCTACAGAAAAGCGAAGAGAGGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link