ENSDARG00000090467

Ensembl ID:
ENSDARG00000090467
Human Orthologues:
COL9A1, COL9A2, COL9A3
Human Descriptions:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
collagen, type IX, alpha 2 [Source:HGNC Symbol;Acc:2218]
collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
Mouse Orthologues:
Col9a1, Col9a2, Col9a3
Mouse Descriptions:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]
collagen, type IX, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88466]
collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24790 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122269 Essential Splice Site 542 607 28 28
Genomic Location:
Chromosome Zv9_NA466 (position 22883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTATGTATAAATGTTTTCTAATTTTATCAATTGTGATTACTTCAAAAC[A/T]GGACCAGCTGGCAAGCCTGGCATTGGTAAAGATGGTCAGGATGGTGCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2dajtui2