ENSDARG00000090451

Ensembl ID:
ENSDARG00000090451
Mouse Orthologue:
2410089E03Rik
Mouse Description:
RIKEN cDNA 2410089E03 gene Gene [Source:MGI Symbol;Acc:MGI:1920942]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15033 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124564 Essential Splice Site 228 460 5 9
Genomic Location:
Chromosome 10 (position 1607588)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACCTTCCTGAAGATCCAGTGGGACTCCACATGGGACAGYAAACTCGGG[T/G]TAGTAGAGGATMAATCTGCTACTGTWTATTACAAATCCAGATGTGCTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ve512wr7