LOC555649

Ensembl ID:
ENSDARG00000090449
Human Orthologues:
SP100, SP140, SP140L
Human Descriptions:
SP100 nuclear antigen [Source:HGNC Symbol;Acc:11206]
SP140 nuclear body protein [Source:HGNC Symbol;Acc:17133]
SP140 nuclear body protein-like [Source:HGNC Symbol;Acc:25105]
Mouse Orthologues:
A530032D15Rik, A530032D15Rik, A630001G21Rik, AC125149.1, AC125149.3, AC125149.7, AC125149.8, AC132444.2, AC132444.3, AC133103.2, AC133103.6, AC168977.2, C130026I21Rik, Sp100, Sp140
Mouse Descriptions:
nuclear antigen Sp100 Gene [Source:MGI Symbol;Acc:MGI:109561]
RIKEN cDNA A530032D15Rik gene Gene [Source:MGI Symbol;Acc:MGI:3037746]
RIKEN cDNA A530032D15Rik gene Gene [Source:MGI Symbol;Acc:MGI:3037746]
RIKEN cDNA A630001G21 gene Gene [Source:MGI Symbol;Acc:MGI:2443131]
RIKEN cDNA C130026I21 gene Gene [Source:MGI Symbol;Acc:MGI:3612702]
Sp140 nuclear body protein Gene [Source:MGI Symbol;Acc:MGI:3702467]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20000 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16470 Essential Splice Site Available for shipment Available now
sa16412 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123017 Essential Splice Site 244 599 6 15
Genomic Location:
Chromosome 3 (position 24868260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTTAAACACACAGATGATCTGACAGCTGTTCCCTTCTCATTCTTTT[A/T]GGAGAATCATCTTCAGTGTCCACCGATGAAGAACAGAGATAGAACATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123017 Essential Splice Site 573 599 14 15
ENSDART00000123017 Essential Splice Site 573 599 14 15
Genomic Location:
Chromosome 3 (position 24880075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGCCTCTGACTTTCAGCTCATTTTCAGCAACTGCAGGAAATTTAATCGGG[T/C]AAGATTTTATGATARCATAATACAGACATCAACAWCAACAACAAAATATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123017 Essential Splice Site 573 599 14 15
ENSDART00000123017 Essential Splice Site 573 599 14 15
Genomic Location:
Chromosome 3 (position 24880075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGCCTCTGACTTTCAGCTCATTTTCAGCAACTGCAGGAAATTTAATCGGG[T/C]AAGATTTTATGATARCATAATACAGACATCAACAWCAACAACAAAATATY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uqunjaf5