MTBP

Ensembl ID:
ENSDARG00000090447
Description:
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa [Sou
Human Orthologue:
MTBP
Human Description:
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa [Sou
Mouse Orthologue:
Mtbp
Mouse Description:
Mdm2, transformed 3T3 cell double minute p53 binding protein Gene [Source:MGI Symbol;Acc:MGI:2146005

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25010 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129251 Essential Splice Site 227 845 8 22
Genomic Location:
Chromosome 16 (position 17403751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTATTGTTGGCACAGCACTTTCTGAATAGCTTTTCTGTGTTGTTTTC[A/T]GTTTGTCTCAGAGCTGAAGTTTGAGGGTTTCTGTCTGAGAGCTCAGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/to6arymd