MTBP

Ensembl ID:
ENSDARG00000090447
Description:
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa [Sou
Human Orthologue:
MTBP
Human Description:
Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa [Sou
Mouse Orthologue:
Mtbp
Mouse Description:
Mdm2, transformed 3T3 cell double minute p53 binding protein Gene [Source:MGI Symbol;Acc:MGI:2146005

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25010 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42689 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129251 Essential Splice Site 227 845 8 22
Genomic Location:
Chromosome 16 (position 17403751)
KASP Assay ID:
554-7407.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTATTGTTGGCACAGCACTTTCTGAATAGCTTTTCTGTGTTGTTTTC[A/T]GTTTGTCTCAGAGCTGAAGTTTGAGGGTTTCTGTCTGAGAGCTCAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129251 Essential Splice Site 594 845 16 22
Genomic Location:
Chromosome 16 (position 17424279)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGATGGACTGCCGAGCGGAGAGCTACAGCCGCTGCCAGTGCTTAGAGG[G/A]TTGGTCATGCACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link