si:ch211-199m9.1

Ensembl ID:
ENSDARG00000090439
ZFIN ID:
ZDB-GENE-081103-63

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20300 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126465 Nonsense 379 1021 3 9
ENSDART00000133238   None 443 None 5
Genomic Location (Zv9):
Chromosome 4 (position 30176209)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 56179791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAGAGCGGCATAAACGTCACTGACACCTCAGTGTATTCTGGGATCTG[C/A]ACTGAGATCTTCAAGGAGGAATCTGTGATTCATCAGAGGAAAGTCTACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link