si:ch211-176d9.3

Ensembl ID:
ENSDARG00000090429
ZFIN ID:
ZDB-GENE-091204-398
Human Orthologue:
C18orf34
Human Description:
chromosome 18 open reading frame 34 [Source:HGNC Symbol;Acc:29588]
Mouse Orthologue:
4921528I01Rik
Mouse Description:
RIKEN cDNA 4921528I01 gene Gene [Source:MGI Symbol;Acc:MGI:1918200]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32495 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122408 Essential Splice Site 69 538 2 12
ENSDART00000136721 Essential Splice Site 377 640 10 16
Genomic Location (Zv9):
Chromosome 24 (position 37303026)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35918452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAAAGAACAATGAAGTAATGCAGCTTCAAAAGCAGATCCAAGCATAC[G/A]TAAGTAATACAGCAGATATAAATCAGGTGAAATTATGAGCCGTGCTGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link