ctrb1

Ensembl ID:
ENSDARG00000090428
ZFIN ID:
ZDB-GENE-030131-1171
Description:
chymotrypsin B1 [Source:RefSeq peptide;Acc:NP_997783]
Human Orthologues:
CTRB1, CTRB2
Human Descriptions:
chymotrypsinogen B1 [Source:HGNC Symbol;Acc:2521]
chymotrypsinogen B2 [Source:HGNC Symbol;Acc:2522]
Mouse Orthologue:
Ctrb1
Mouse Description:
chymotrypsinogen B1 Gene [Source:MGI Symbol;Acc:MGI:88559]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11393 Nonsense Available for shipment Available now
sa25368 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34120 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21002 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037346   None 263 None 7
ENSDART00000109691 Nonsense 48 459 2 13

The following transcripts of ENSDARG00000090428 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 36522967)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34796810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCCAGGATTGTRAACGGTGAGGAGGCTGTCCCTCATTCCTGGCCCTGG[C/T]AGGTGTCTCTGCAGRTATGAAYAGACAGATTTTCACTTACAGATGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037346   None 263 None 7
ENSDART00000109691 Essential Splice Site 53 459 None 13

The following transcripts of ENSDARG00000090428 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 36523064)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34796907
KASP Assay ID:
554-7835.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAGGATAGGCAACTGTGAATAAAAAAATTGATCTGATGTTTAATGTA[A/G]GGACTCCACCGGCTTCCACTTCTGCGGAGGCTCCCTGATCAACGAGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037346   None 263 None 7
ENSDART00000109691 Essential Splice Site 166 459 None 13

The following transcripts of ENSDARG00000090428 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 36524035)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34797878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATTTTCTTTCGTGCAAGCTTTCAAACACATTTTTGTAACTTTTTTTT[A/T]GCTCCTGATACCCCTGCCCTGCTCCAGCAGGCCGCTCTGCCTCTGCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037346 Nonsense 187 263 6 7
ENSDART00000109691 Nonsense 383 459 12 13

The following transcripts of ENSDARG00000090428 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 36532891)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34806734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCCTGCTCCAGCAGGCCGCTCTGCCTCTGCTGACCAATGATGACTGC[A/T]AGCGTTACTGGGGAACCAACATCACTGATCTGATGATCTGCGCTGGAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link