ENSDARG00000090419

Ensembl ID:
ENSDARG00000090419
Human Orthologues:
C13orf23, NUP214
Human Descriptions:
chromosome 13 open reading frame 23 [Source:HGNC Symbol;Acc:20291]
nucleoporin 214kDa [Source:HGNC Symbol;Acc:8064]
Mouse Orthologues:
2810046L04Rik, Nup214
Mouse Descriptions:
nucleoporin 214 Gene [Source:MGI Symbol;Acc:MGI:1095411]
RIKEN cDNA 2810046L04 gene Gene [Source:MGI Symbol;Acc:MGI:1919933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25911 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123827 Nonsense 442 1039 2 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 47442987)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47448159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCTGCAGCACCATCATCTTCACCATCACCAAACTCTCCCCCATCTT[C/A]ATCATCCTCACCTGCAGCACCAAACTTTCCATCATCTTCATCATCCTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link