PLCB2

Ensembl ID:
ENSDARG00000090381
Description:
phospholipase C, beta 2 [Source:HGNC Symbol;Acc:9055]
Human Orthologue:
PLCB2
Human Description:
phospholipase C, beta 2 [Source:HGNC Symbol;Acc:9055]
Mouse Orthologue:
Plcb2
Mouse Description:
phospholipase C, beta 2 Gene [Source:MGI Symbol;Acc:MGI:107465]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16007 Essential Splice Site Available for shipment Available now
sa6455 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121614 Essential Splice Site 120 679 3 16
Genomic Location (Zv9):
Chromosome 17 (position 1760919)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2203868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACGATCAKGATGAACAGGATGAAGAGAAGATGAAGAACTCTGATGAG[G/A]TRAACAGAAACTACAGTATTTTTGTYTATTGGCAAAAAANTGCTTCTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121614 Nonsense 338 679 9 16
Genomic Location (Zv9):
Chromosome 17 (position 1753881)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2196830
KASP Assay ID:
554-4183.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTATCCCTGTGTGTGTGAACAGGTCTTGCTGCCAGAGATGGCCTATCTC[A/T]GACTGGTGGTCCAGGAAGAAGGAGGAAAGTTCATTGGTCACCGCAWCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link