si:ch211-71c16.6

Ensembl ID:
ENSDARG00000090380
ZFIN ID:
ZDB-GENE-091204-352
Human Orthologue:
GZMM
Human Description:
granzyme M (lymphocyte met-ase 1) [Source:HGNC Symbol;Acc:4712]
Mouse Orthologue:
Gzmm
Mouse Description:
granzyme M (lymphocyte met-ase 1) Gene [Source:MGI Symbol;Acc:MGI:99549]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29562 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123168 Nonsense 97 257 3 5
Genomic Location (Zv9):
Chromosome 21 (position 18346361)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19481850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTCTATCTCTGAGTAAAGGCTCTCAACGTATTGGCATCCTTAATTA[C/A]GAAATCCCTAAAACATTCAATGAAAAGACTAAAGAAGATGACATCATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link