ALPK3 (2 of 2)

Ensembl ID:
ENSDARG00000090375
Description:
alpha-kinase 3 [Source:HGNC Symbol;Acc:17574]
Human Orthologue:
ALPK3
Human Description:
alpha-kinase 3 [Source:HGNC Symbol;Acc:17574]
Mouse Orthologue:
Alpk3
Mouse Description:
alpha-kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2151224]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9870 Nonsense Available for shipment Available now
sa20972 Nonsense Mutation detected in F1 DNA During 2014
sa18304 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125351 Nonsense 547 1869 3 12
Genomic Location:
Chromosome 7 (position 31457875)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAYRCCAGTAAAAGTAAACAAATGTGCCTCAGAAGAGTTAGAGATAAGT[C/T]AGAGTGCTAAGATCACCTCAGCGATGGAACATRGAAWCAAASTGRACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125351 Nonsense 629 1869 3 12
Genomic Location:
Chromosome 7 (position 31457629)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAAAACAGTCAGTATATACAGATGAAAATGTTTCCAAAGTATCAAAT[A/T]AAGCTCAAGAAGCTCCGGGAGCCTCAGTGTCTGCCAAAGCCAAAATGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125351 Nonsense 1748 1869 10 12
Genomic Location:
Chromosome 7 (position 31448121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGGTAMTCRATGAGAAGTCAGAGGTGGGACAAAAGTGCTCATCTCTC[C/T]AGCACTGGATCCACCAGTGGACCAGCGGAAATGTGCTGTTCTCAAGACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qtqnnx4e