DCC

Ensembl ID:
ENSDARG00000090360
Description:
deleted in colorectal carcinoma [Source:HGNC Symbol;Acc:2701]
Human Orthologue:
DCC
Human Description:
deleted in colorectal carcinoma [Source:HGNC Symbol;Acc:2701]
Mouse Orthologue:
Dcc
Mouse Description:
deleted in colorectal carcinoma Gene [Source:MGI Symbol;Acc:MGI:94869]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25288 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31409 Nonsense Available for shipment Available now
sa16961 Nonsense Available for shipment Available now
sa12693 Essential Splice Site Available for shipment Available now
sa13121 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126752 Essential Splice Site 53 895 2 32
Genomic Location (Zv9):
Chromosome 5 (position 97301)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 146661
KASP Assay ID:
554-7843.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGGTATCCCCCTGAGCTCTCCTGATTGGCTATCGTGTGTGGTGTTC[A/G]GGATGGTGGTCATCTGCAGATTCTGGGTCTGGTGCGCTCAGATGAAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126752 Nonsense 281 895 6 32
Genomic Location (Zv9):
Chromosome 5 (position 79307)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTACAGTTTGCGAGTGCTGGCGGTGAACCGACACGGCCCCGGGGTCT[C/A]GGATAAAGACACACTCATCACCACGCTCTCAGACGGTAAGAACATAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126752 Nonsense 674 895 27 32
Genomic Location (Zv9):
Chromosome 5 (position 52632)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 171153
KASP Assay ID:
2259-5299.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATCAGGTGCTGGACCTCAATCTGGACACMGTCTACTATTTCCGCATC[C/T]AGGCCAAAAACGCTAAAGGAGTCGGGCCGYTGTCGGACCCCGTGCAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126752 Essential Splice Site 705 895 28 32
Genomic Location (Zv9):
Chromosome 5 (position 50130)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 168651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGTCTCTCCTGTAGTTGAGCATCCGGATAAGAKGGCCAATGATCAAG[G/A]TAAGCTGATTCTCCCTCGTCATCTTTAATAAATCARCTCTGTGTTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126752 Nonsense 848 895 31 32
Genomic Location (Zv9):
Chromosome 5 (position 41340)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 159861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCARAGCTGCCAGGAGATCCCTCCAGTCAGCCACAGCCAATCAGAGAGC[C/T]AGATGGGCAGCAAGAGCAGCCACTCAGGTGAGGCTGCAGGCGGGCTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link