ENSDARG00000090356

Ensembl ID:
ENSDARG00000090356
Human Orthologue:
DENND1A
Human Description:
DENN/MADD domain containing 1A [Source:HGNC Symbol;Acc:29324]
Mouse Orthologue:
Dennd1a
Mouse Description:
DENN/MADD domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:2442794]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24176 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11283 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122451 Essential Splice Site 59 99 4 5
Genomic Location:
Chromosome 22 (position 25086098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCCTGCAGACAGTGCCTAAGTTCTGCTTCCCATTTGACGTGGAAAGG[T/C]AGGACATCCCTCTCGCTTCCCAGCAAATAAGCCAATCGATGTGTGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122451 Nonsense 97 99 5 5
Genomic Location:
Chromosome 22 (position 25087123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTTWGGGTTCTGTCGGCTRACGTCCGGCTGCAAGCTCTGCATCTGCT[T/A]GCTCAGGTAAGAGAAATGAGAACATGACCGATTTRTTTTATCCTCAATCW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Personality dimensions: A genome-wide association study of Cloninger's temperament scales: implications for the evolutionary genetics of personality. (View Study)
  • Polycystic ovary syndrome: Genome-wide association study identifies susceptibility loci for polycystic ovary syndrome on chromosome 2p16.3, 2p21 and 9q33.3. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3dy0ur2d