MLLT4 (2 of 2)

Ensembl ID:
ENSDARG00000090354
Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 [Sour
Human Orthologue:
MLLT4
Human Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 [Sour
Mouse Orthologue:
Mllt4
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38204 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129368 Essential Splice Site 29 400 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA655 (position 4886)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150452.1 4886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCTTCCCCCTATGGATAACCACTCCAACAACAGCATGGCTATGCAGG[T/C]TAGCCTTTTTAGGAATTGAATGCATGGTATCCAGGGGCCACAGACAGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link