ENSDARG00000090346

Ensembl ID:
ENSDARG00000090346

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6768 Nonsense Mutation detected in F1 DNA During 2014
sa17605 Nonsense Available for shipment Available now
sa16803 Nonsense Available for shipment Available now
sa9899 Nonsense Available for shipment Available now
sa24504 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130053 Nonsense 251 1515 5 5
Genomic Location:
Chromosome 24 (position 24600913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTAAAGAAGGAATCTGGAGGCCCTAGAGAGAATGCTCCAACAACTCTA[C/T]AAAACCACAATAATCTGGACAGTGTTCTAAAAKCAAGCACTGATTCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130053 Nonsense 365 1515 5 5
Genomic Location:
Chromosome 24 (position 24600571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTAATWCAACAGGATTGGCGGCAACAACCTTATCTTCCTTTCCARAGG[C/T]AACCATCTGAACACATGATGGCCAATGACAGTAACATGCAGGTGAATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130053 Nonsense 755 1515 5 5
Genomic Location:
Chromosome 24 (position 24599401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGYTCATCTCTGTCCTCCCCTTCCCCTTCCACCCCTTTGTCCCAGATA[C/T]AGAATGCTGAAACCTCACCTCCTAAACAAGATGGGGGTGTAAAACAGCWT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130053 Nonsense 817 1515 5 5
Genomic Location:
Chromosome 24 (position 24599214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTATKCAGCTCCWGCTCAATCTCTGCCTCCTGACTTTGGAAGAGGAT[C/A]AGCACCTCGYCTCAGCACTTCTCCGTATTCTAGCCTCATCTCCTCAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130053 Nonsense 840 1515 5 5
Genomic Location:
Chromosome 24 (position 24599145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCGTATTCTAGCCTCATCTCCTCAAGACCTGCACTGAGTAGTACTT[T/G]ACAAGGACTGTCCTCTCCACCTGTGCCTGAAACACATACCCGATCTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jxv416xz