CCDC37 (2 of 2)

Ensembl ID:
ENSDARG00000090342
Description:
coiled-coil domain containing 37 [Source:HGNC Symbol;Acc:26842]
Human Orthologue:
CCDC37
Human Description:
coiled-coil domain containing 37 [Source:HGNC Symbol;Acc:26842]
Mouse Orthologue:
Ccdc37
Mouse Description:
coiled-coil domain containing 37 Gene [Source:MGI Symbol;Acc:MGI:2141635]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40673 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123507 Essential Splice Site 371 552 11 15
Genomic Location (Zv9):
Chromosome 6 (position 21510692)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17771683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCATTGGAGGAGTTCAGACAGAATGCTGAAGTGATTCACAAGAACAT[G/A]TTTGTACCTGCATGTCATAGTTATCTTTTTTACATTTCTTTATTCCAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link