FAM83G (1 of 2)

Ensembl ID:
ENSDARG00000090340
Description:
family with sequence similarity 83, member G [Source:HGNC Symbol;Acc:32554]
Human Orthologue:
FAM83G
Human Description:
family with sequence similarity 83, member G [Source:HGNC Symbol;Acc:32554]
Mouse Orthologue:
Fam83g
Mouse Description:
family with sequence similarity 83, member G Gene [Source:MGI Symbol;Acc:MGI:1916890]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33263 Nonsense Mutation detected in F1 DNA During 2016
sa18193 Nonsense Available for shipment Available now
sa40130 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123292 Nonsense 35 1642 1 5
Genomic Location (Zv9):
Chromosome 3 (position 39621871)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39485231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGAGTCCAAGCCGGAGTTTTTGTACAGTGAAGGTCAGAGACTCGCGT[T/A]GGAGACACTGATCCACGCCGGACGGGACGCTTTTGAGGACTACATCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123292 Nonsense 899 1642 4 5
Genomic Location (Zv9):
Chromosome 3 (position 39616771)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39480131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACATCAAAGCCAGCGGTAGACACTGAATCGATGAGCAGTGTTTTGCAA[C/T]AACAWATGGCACGTGCATCTCAACAGTTTTTAGAGAGACAAACCAAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123292 Nonsense 1066 1642 4 5
Genomic Location (Zv9):
Chromosome 3 (position 39616269)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39479629
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAAGAAAAATTCTGAGTCTGGCTTTGTGTCTGAGGTTAGTGTAGATT[T/A]AGTATGTGAGGAACAGTCTGTACAGACTCTCCAGGACTTACATCCCGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link